![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gma-MIR159a |
|||||
Accession | MI0001773 (change log) | ||||
Previous IDs | gma-MIR159 | ||||
Description | Glycine max miR159a stem-loop | ||||
Gene family | MIPF0000010; MIR159 | ||||
Literature search |
![]()
25 open access papers mention gma-MIR159a | ||||
Stem-loop |
aauu uuaugaa ga uu aucu ---- ug u g c uc uu - ucaaua 5' aaagggga guggagcuccuu aguccaa gagg uacu ggg aau gagcu cuuag uaugga ccacag cuacc ca a |||||||| |||||||||||| ||||||| |||| |||| ||| ||| ||||| ||||| |||||| |||||| ||||| || 3' uuucuucu caucucgaggga uuagguu uucc auga ucc uua uucga ggguc auaccu gguguu gaugg gu g -ucu cuuccca ag uc aauu uauu gu c g u uc cu u uuucgu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence gma-miR159a-5p |
|
Accession | MIMAT0020919 |
Sequence |
23 - gagcuccuugaaguccaauug - 43 |
Evidence | experimental; Illumina [3] |
Mature sequence gma-miR159a-3p |
|
Accession | MIMAT0001675 |
Previous IDs | gma-miR159;gma-miR159a |
Sequence |
175 - uuuggauugaagggagcucua - 195 |
Evidence | experimental; 454 [1], Illumina [3] |
References |
|
1 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
2 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
3 |
PMID:21663675
"Identification of novel soybean microRNAs involved in abiotic and biotic stresses"
BMC Genomics. 12:307(2011).
|