![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence zma-MIR319a |
|||||
Accession | MI0001813 (change log) | ||||
Description | Zea mays miR319a stem-loop | ||||
Gene family | MIPF0000010; MIR159 | ||||
Literature search |
![]()
22 open access papers mention zma-MIR319a | ||||
Stem-loop |
gguucauguuuucucu a u cu ug u --ca g ac ac a ug c 5' ggaag gagc cucuucagucca c aaauggc guaggguuu uuagcu ccg ucauccauuc cugccaaga cca ga a ||||| |||| |||||||||||| | ||||||| ||||||||| |||||| ||| |||||||||| ||||||||| ||| || 3' uuuuc cucg gggaagucaggu g uuugucg caucucgaa aaucga ggc ggugggugag gaugguucu ggu cu g -ucgcaaacucguuug c u ug ug - cuaa g gc cc - -- g |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence zma-miR319a-5p |
|
Accession | MIMAT0015180 |
Previous IDs | zma-miR319a* |
Sequence |
23 - gagcucucuucaguccacuc - 42 |
Deep sequencing | 168 reads, 125 experiments |
Evidence | experimental; Illumina [2] |
Mature sequence zma-miR319a-3p |
|
Accession | MIMAT0001715 |
Previous IDs | zma-miR319a |
Sequence |
171 - uuggacugaagggugcuccc - 190 |
Deep sequencing | 4519 reads, 211 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
References |
|
1 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
2 |
PMID:19936050
"A genome-wide characterization of microRNA genes in maize"
PLoS Genet. 5:e1000716(2009).
|