![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptc-MIR156d |
|
Accession | MI0002187 (change log) |
Description | Populus trichocarpa miR156d stem-loop |
Gene family | MIPF0000008; MIR156 |
Literature search |
![]()
8 open access papers mention ptc-MIR156d |
Stem-loop |
guaa a u - a a a acu uu a 5' gug g ugacaga agag gug gcac cagggu uuc gcaug c ||| | ||||||| |||| ||| |||| |||||| ||| ||||| g 3' uac c acugucu ucuc cac cgug guuucg aag cguac u --ac c c a c c c --- uu u |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence ptc-miR156d |
|
Accession | MIMAT0001893 |
Sequence |
11 - ugacagaagagagugagcac - 30 |
Evidence | by similarity; MI0002190 |
References |
|
1 |
PMID:15994906
"Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis"
Plant Cell. 17:2186-2203(2005).
|
2 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
3 |
PMID:16973872
"The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)"
Science. 313:1596-1604(2006).
|