![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptc-MIR156i |
|||||
Accession | MI0002192 (change log) | ||||
Description | Populus trichocarpa miR156i stem-loop | ||||
Gene family | MIPF0000008; MIR156 | ||||
Literature search |
![]()
9 open access papers mention ptc-MIR156i | ||||
Stem-loop |
---u uuguu a - u - uuu g ua 5' gugaug g cagaag auagagagcacaga ga ug u cag g |||||| | |||||| |||||||||||||| || || | ||| 3' cacuac c gucuuc uaucucucguguuu cu ac a guc a cuuc ----- - g c c ucu g uc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence ptc-miR156i |
|
Accession | MIMAT0001898 |
Sequence |
11 - uugacagaagauagagagcac - 31 |
Evidence | experimental; cloned [1] |
References |
|
1 |
PMID:15994906
"Novel and mechanical stress-responsive MicroRNAs in Populus trichocarpa that are absent from Arabidopsis"
Plant Cell. 17:2186-2203(2005).
|
2 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
3 |
PMID:16973872
"The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)"
Science. 313:1596-1604(2006).
|