![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ptc-MIR396e |
|
Accession | MI0002329 (change log) |
Description | Populus trichocarpa miR396e stem-loop |
Gene family | MIPF0000047; MIR396 |
Literature search |
![]()
7 open access papers mention ptc-MIR396e |
Stem-loop |
ggu c a -uu cuugcuuaaucuguguauauauagaucacuacaug 5' caug uuuuccacagcuuucuuga cuucu gc u |||| ||||||||||||||||||| ||||| || 3' guac agagggugucgaaagaacu gaagg cg a --g a c uac cgauauguauguauauaaauauauauauccucgac |
Confidence |
Annotation confidence: not enough data
|
Database links |
|
Mature sequence ptc-miR396e-5p |
|
Accession | MIMAT0002035 |
Previous IDs | ptc-miR396e |
Sequence |
11 - uuccacagcuuucuugaacuu - 31 |
Evidence | experimental; miRNAseq [4] |
Mature sequence ptc-miR396e-3p |
|
Accession | MIMAT0022910 |
Sequence |
120 - cucaagaaagcugugggaga - 139 |
Evidence | experimental; miRNAseq [4] |
References |
|
1 |
PMID:15916721
"Identification and characterization of new plant microRNAs using EST analysis"
Cell Res. 15:336-360(2005).
|
2 |
"Conservation and divergence of microRNA families in plants"
http://genomebiology.com/2005/6/11/p13 (2005).
|
3 |
PMID:16973872
"The genome of black cottonwood, Populus trichocarpa (Torr. & Gray)"
Science. 313:1596-1604(2006).
|
4 |
PMID:22442676
"Deep annotation of Populus trichocarpa microRNAs from diverse tissue sets"
PLoS One. 7:e33034(2012).
|