Stem-loop sequence hsa-mir-193b

Accession

MI0003137 (change log)

Symbol

HGNC:MIR193B

Description

Homo sapiens miR-193b stem-loop

Gene family

MIPF0000082; mir-193

Literature search

160 open access papers mention hsa-mir-193b
(413 sentences)

Stem-loop

      gu       u    gu         g  a  ag uua 
5' gug  cucagaa cggg  uuugagggc ag ug  u   u
   |||  ||||||| ||||  ||||||||| || ||  |   g
3' uac  ggguuuu gccc  aaacucccg uc ac  a   u
      ug       c    ug         g  a  cu uuu 

Deep sequencing

192789 reads, 658 reads per million, 160 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr16: 14303967-14304049 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000436626 ; MKL2-011; intron 1

  OTTHUMT00000436627 ; MKL2-004; intron 1

  OTTHUMT00000436628 ; MKL2-005; intron 1

  OTTHUMT00000436621 ; MKL2-001; intron 3

  OTTHUMT00000436622 ; MKL2-002; intron 3

  OTTHUMT00000436619 ; MKL2-007; intron 4

  ENST00000575768 ; MKL2-011; intron 1

  ENST00000572567 ; MKL2-004; intron 1

  ENST00000573051 ; MKL2-005; intron 1

  ENST00000341243 ; MKL2-202; intron 1

  ENST00000318282 ; MKL2-201; intron 2

  ENST00000571589 ; MKL2-001; intron 3

  ENST00000574045 ; MKL2-002; intron 3

  ENST00000574998 ; MKL2-007; intron 4

Clustered miRNAs

< 10kb from hsa-mir-193b

• hsa-mir-193b: chr16: 14303967-14304049 [+]
• hsa-mir-365a: chr16: 14309285-14309371 [+]

Database links

• EntrezGene:MIR193B
• HGNC:MIR193B
• RNAcentral:URS000075BAEB_9606
• miRBase Tracker:MI0003137

Mature sequence hsa-miR-193b-5p

• Accession: MIMAT0004767
• Previous IDs: hsa-miR-193b*
• Sequence: 14 - cgggguuuugagggcgagauga - 35
• Deep sequencing: 28800 reads, 157 experiments
• Evidence: experimental; cloned [3-4]
• Database links:
  • RNAcentral:URS00000E1DC5_9606
• Predicted targets:
  • TargetMiner:hsa-miR-193b-5p
  • TargetScanVert:hsa-miR-193b-5p
  • miRDB:hsa-miR-193b-5p
  • microrna.org:hsa-miR-193b-5p

Mature sequence hsa-miR-193b-3p

• Accession: MIMAT0002819
• Previous IDs: hsa-miR-193b
• Sequence: 51 - aacuggcccucaaagucccgcu - 72
• Deep sequencing: 163980 reads, 159 experiments
• Evidence: experimental; array-cloned [1], cloned [2-4]
• Database links:
  • RNAcentral:URS00000AA464_9606
• Predicted targets:
  • TargetMiner:hsa-miR-193b-3p
  • TargetScanVert:hsa-miR-193b-3p
  • miRDB:hsa-miR-193b-3p
  • microrna.org:hsa-miR-193b-3p

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).