miRBase entry: mmu-mir-542

Stem-loop mmu-mir-542


Accession
MI0003522
Symbol
MGI: Mir542
Description
Mus musculus mmu-mir-542 precursor miRNA
Gene family
MIPF0000185; mir-542

Literature search
22 open access papers mention mmu-mir-542
(154 sentences)

Sequence

43807 reads, 358 reads per million, 106 experiments
ggaucucagacguCUCGGGGAUCAUCAUGUCACGAgauaccacugugcccuUGUGACAGAUUGAUAACUGAAAggucugggagcc
((.((((((((.(.((((..((((...(((((((((.(((....)))..)))))))))...))))..)))).).)))))))).))

Structure
  a        g C    GG    UCA         -a   c 
gg ucucagac u UCGG  AUCA   UGUCACGAg  uac a
|| |||||||| | ||||  ||||   |||||||||  |||  
cc agggucug A AGUC  UAGU   ACAGUGUuc  gug c
  g        g A    AA    UAG         cc   u 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
chrX: 53049403-53049487 [-]
Clustered miRNAs
6 other miRNAs are < 10 kb from mmu-mir-542
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mmu-miR-542-5p

Accession MIMAT0003171
Description Mus musculus mmu-miR-542-5p mature miRNA
Sequence 14 - CUCGGGGAUCAUCAUGUCACGA - 35
Evidence experimental
cloned [1,4], miRAP-cloned [3], Illumina [5]
Database links
Predicted targets

Mature mmu-miR-542-3p

Accession MIMAT0003172
Description Mus musculus mmu-miR-542-3p mature miRNA
Sequence 52 - UGUGACAGAUUGAUAACUGAAA - 73
Evidence experimental
cloned [1,4], MPSS [2], miRAP-cloned [3], Illumina [5-6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  3. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  4. PubMed ID: 16582102
    The expression profile of microRNAs in mouse embryos
    "Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I"
    "Nucleic Acids Res (2006) 34:1765-1771

  5. PubMed ID: 16274478
    Identification of clustered microRNAs using an ab initio prediction method
    Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M
    BMC Bioinformatics (2005) 6:267

  6. PubMed ID: 16973894
    Mouse microRNA profiles determined with a new and sensitive cloning method
    "Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H"
    "Nucleic Acids Res (2006) 34:e115