Stem-loop sequence bta-mir-103-1

AccessionMI0004736 (change log)
Previous IDsbta-mir-103
DescriptionBos taurus miR-103-1 stem-loop
Gene family MIPF0000024; mir-103
Literature search

34 open access papers mention bta-mir-103-1
(226 sentences)

Stem-loop 
   cu   c  --    u  u           c   u g a 
5'   gcc uc  ggcu cu uacagugcugc uug u c u
     ||| ||  |||| || ||||||||||| ||| | |  
3'   cgg ag  ucgg ga auguuacgacg aac a g a
   --   a  ua    -  c           -   u g u
Get sequence
Deep sequencing
228062 reads, 1.52e+03 reads per million, 78 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 189696-189767 [-]
sense
ENSBTAT00000015780 ; PANK3-201; intron 5
Database links

Mature sequence bta-miR-103

Accession MIMAT0003521
Sequence

46 -  

agcagcauuguacagggcuauga

 - 68

Get sequence
Deep sequencing456125 reads, 78 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:17306260 "Identification and characterization of microRNAs from the bovine adipose tissue and mammary gland" Gu Z, Eleswarapu S, Jiang H FEBS Lett. 581:981-988(2007).