Stem-loop sequence bta-mir-192

AccessionMI0005035 (change log)
DescriptionBos taurus miR-192 stem-loop
Gene family MIPF0000063; mir-192
Literature search

13 open access papers mention bta-mir-192
(36 sentences)

Stem-loop 
   ----agacc   u  --   g g  c         -     a       ----u  uc 
5'          gag gc  aca g cu ugaccuaug aauug cagccag     gc  u
            ||| ||  ||| | || ||||||||| ||||| |||||||     ||   
3'          cuc cg  ugu u ga acuggauac uuaac gucgguc     ug  u
   cgaccguaa   -  cu   a g  c         c     c       ucccc  ug
Get sequence
Deep sequencing
15763070 reads, 1.27e+05 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr29: 44018495-44018600 [+]
intergenic
Clustered miRNAs
< 10kb from bta-mir-192
bta-mir-194-2chr29: 44018295-44018377 [+]
bta-mir-194b-2chr29: 44018309-44018361 [-]
bta-mir-192chr29: 44018495-44018600 [+]
Database links

Mature sequence bta-miR-192

Accession MIMAT0003820
Sequence

20 -  

cugaccuaugaauugacagccag

 - 42

Get sequence
Deep sequencing15760131 reads, 78 experiments
Evidence experimental; cloned [1,3], Array [2], qRT-PCR [2]
Predicted targets

References

1
PMID:17105755 "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP Physiol Genomics. 29:35-43(2007).
2
PMID:19170227 "Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach" Tesfaye D, Worku D, Rings F, Phatsara C, Tholen E, Schellander K, Hoelker M Mol Reprod Dev. 76:665-677(2009).
3
PMID:19267191 "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" Long JE, Chen HX Biochem Genet. 47:329-343(2009).