![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bta-mir-192 |
||||||||
Accession | MI0005035 (change log) | |||||||
Description | Bos taurus miR-192 stem-loop | |||||||
Gene family | MIPF0000063; mir-192 | |||||||
Literature search |
![]()
13 open access papers mention bta-mir-192 | |||||||
Stem-loop |
----agacc u -- g g c - a ----u uc 5' gag gc aca g cu ugaccuaug aauug cagccag gc u ||| || ||| | || ||||||||| ||||| ||||||| || 3' cuc cg ugu u ga acuggauac uuaac gucgguc ug u cgaccguaa - cu a g c c c ucccc ug |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence bta-miR-192 |
|
Accession | MIMAT0003820 |
Sequence |
20 - cugaccuaugaauugacagccag - 42 |
Deep sequencing | 15760131 reads, 78 experiments |
Evidence | experimental; cloned [1,3], Array [2], qRT-PCR [2] |
Predicted targets |
|
References |
|
1 |
PMID:17105755
"Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues"
Physiol Genomics. 29:35-43(2007).
|
2 |
PMID:19170227
"Identification and expression profiling of microRNAs during bovine oocyte maturation using heterologous approach"
Mol Reprod Dev. 76:665-677(2009).
|
3 |
PMID:19267191
"Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning"
Biochem Genet. 47:329-343(2009).
|