![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sme-mir-92 |
|||||
Accession | MI0005156 (change log) | ||||
Description | Schmidtea mediterranea miR-92 stem-loop | ||||
Literature search |
1 open access papers mention sme-mir-92 | ||||
Stem-loop |
- cuaa a u g --c ug 5' aauug augguaa ua cuagugcaa ucua agg a ||||| ||||||| || ||||||||| |||| ||| 3' uuaac uacuauu au gaucacguu agau ucu a u auac a u - uuu uu |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sme-miR-92-5p |
|
Accession | MIMAT0012111 |
Previous IDs | sme-miR-92* |
Sequence |
11 - ugguaaauaucuagugcaaguc - 32 |
Evidence | experimental; 454 [2], Illumina [2-3] |
Mature sequence sme-miR-92-3p |
|
Accession | MIMAT0003991 |
Previous IDs | sme-miR-92 |
Sequence |
53 - gauugcacuaguuaauuauc - 72 |
Evidence | experimental; cloned [1], Northern [1], 454 [2], Illumina [2] |
References |
|
1 |
PMID:16849698
"MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology"
RNA. 12:1640-1649(2006).
|
2 |
PMID:19564616
"High-resolution profiling and discovery of planarian small RNAs"
Proc Natl Acad Sci U S A. 106:11546-11551(2009).
|
3 |
PMID:19553344
"Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea"
RNA. 15:1483-1491(2009).
|