![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sme-mir-277c |
||||||
Accession | MI0005170 (change log) | |||||
Description | Schmidtea mediterranea miR-277c stem-loop | |||||
Literature search |
1 open access papers mention sme-mir-277c | |||||
Stem-loop |
auauua -u au - aa 5' aucauuu aucauaucagau ugcauu uauu aug u ||||||| |||||||||||| |||||| |||| ||| u 3' uaguaaa uaguauggucua acguaa auaa uac a -guuua uu -- c aa |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence sme-miR-277c-5p |
|
Accession | MIMAT0012120 |
Previous IDs | sme-miR-277c* |
Sequence |
14 - aucauaucagauuugcauuauu - 35 |
Evidence | experimental; 454 [2], Illumina [2-3] |
Mature sequence sme-miR-277c-3p |
|
Accession | MIMAT0004010 |
Previous IDs | sme-miR-277c |
Sequence |
55 - uaaaugcauuaucugguaugau - 76 |
Evidence | experimental; cloned [1], Northern [1], 454 [2], Illumina [2] |
References |
|
1 |
PMID:16849698
"MicroRNAs from the Planarian Schmidtea mediterranea: a model system for stem cell biology"
RNA. 12:1640-1649(2006).
|
2 |
PMID:19564616
"High-resolution profiling and discovery of planarian small RNAs"
Proc Natl Acad Sci U S A. 106:11546-11551(2009).
|
3 |
PMID:19553344
"Deep sequencing identifies new and regulated microRNAs in Schmidtea mediterranea"
RNA. 15:1483-1491(2009).
|