Stem-loop sequence mdo-mir-9a-2

AccessionMI0005271 (change log)
DescriptionMonodelphis domestica miR-9a-2 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   g    u     g   uc               g      ug a 
5'  gaag gaguu uua  uuugguuaucuagcu uaugag  u u
    |||| ||||| |||  ||||||||||||||| ||||||  |  
3'  cuuc cucaa aau  aagccaauagaucga auacuu  g u
   a    -     a   ga               a      cu g 
Get sequence
Deep sequencing
2380665 reads, 3.39e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 215711846-215711932 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-9a-2
mdo-mir-9a-2chr3: 215711846-215711932 [+]
mdo-mir-9c-2chr3: 215711861-215711916 [-]
Database links

Mature sequence mdo-miR-9a-5p

Accession MIMAT0004087
Previous IDsmdo-miR-9
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Deep sequencing6991910 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mdo-miR-9a-3p

Accession MIMAT0004088
Previous IDsmdo-miR-9*
Sequence

53 - 

auaaagcuagauaaccgaaagu

 - 74

Get sequence
Deep sequencing145444 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1