Stem-loop sequence tae-MIR1138

AccessionMI0006200 (change log)
DescriptionTriticum aestivum miR1138 stem-loop
Literature search

2 open access papers mention tae-MIR1138
(2 sentences)

Stem-loop
   aucuuguaua   c   c   ga        a    gaca   cu                ga  u   c c   -u      cuauuuuuuuuauccu 
5'           ggu ugu uag  cacaucua augu    uaa  augucacaucuaagcu  ug caa u ugu  uguggu                a
             ||| ||| |||  |||||||| ||||    |||  ||||||||||||||||  || ||| | |||  ||||||                g
3'           uca aca auu  guguagau uaca    auu  uacaguguagauucga  au guu a aua  acaucg                u
   ----uucuag   a   a   aa        c    -aaa   cc                gg  -   u u   uu      uuauucuuuauuuuuu 
Get sequence
Deep sequencing
7160 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Comments

Yao et al. misname this sequence miR522 in [1]. miR1138 is unrelated to mammalian miR-522;

Database links

Mature sequence tae-miR1138

Accession MIMAT0005373
Sequence

140 - 

gcuuagaugugacauccuuaaaa

 - 162

Get sequence
Deep sequencing1407 reads, 116 experiments
Evidence experimental; cloned [1]

References

1
PMID:17543110 "Cloning and characterization of microRNAs from wheat (Triticum aestivum L.)" Yao Y, Guo G, Ni Z, Sunkar R, Du J, Zhu JK, Sun Q Genome Biol. 8:R96(2007).