Stem-loop sequence cfa-mir-379

AccessionMI0008134 (change log)
DescriptionCanis familiaris miR-379 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   --    a       ga       - uuugu 
5'   uggu gacuaug  acguagg c     g
     |||| |||||||  ||||||| |      
3'   auca cugguac  uguaucc g     a
   ca    c       aa       a uuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69253808-69253866 [+]
sense
ENSCAFT00000039938 ; cfa-mir-379-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-379
cfa-mir-379chr8: 69253808-69253866 [+]
cfa-mir-411chr8: 69255094-69255151 [+]
cfa-mir-299chr8: 69255548-69255610 [+]
cfa-mir-380chr8: 69256764-69256820 [+]
cfa-mir-323chr8: 69257494-69257549 [+]
cfa-mir-758chr8: 69257782-69257862 [+]
cfa-mir-329bchr8: 69258528-69258607 [+]
cfa-mir-329achr8: 69258855-69258914 [+]
cfa-mir-494chr8: 69261385-69261465 [+]
cfa-mir-543chr8: 69263406-69263463 [+]
Database links

Mature sequence cfa-miR-379

Accession MIMAT0006715
Sequence

1 - 

ugguagacuauggaacguagg

 - 21

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).