![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aga-mir-981 |
|||||
Accession | MI0008307 (change log) | ||||
Description | Anopheles gambiae miR-981 stem-loop | ||||
Gene family | MIPF0000710; mir-981 | ||||
Literature search |
3 open access papers mention aga-mir-981 | ||||
Stem-loop |
- gau c u u ---------- ga 5' gccuua ucug cggguuucg uggc aacg guug ugc g |||||| |||| ||||||||| |||| |||| |||| ||| 3' cggaau aggc guccaaagc gcug uugc uaac acg c g -ac a - u uucaaaaaaa ag |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This mature miRNA was cloned from Anopheles stepheni, and mapped to the A. gambiae genome [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aga-miR-981 |
|
Accession | MIMAT0007857 |
Sequence |
63 - uucguugucgacgaaaccug - 82 |
Evidence | not experimental |
References |
|
1 |
PMID:18500992
"Cloning, characterization, and expression of microRNAs from the Asian malaria mosquito, Anopheles stephensi"
BMC Genomics. 9:244(2008).
|