Bta-mir-92a is a microRNA that has been identified as a potential diagnostic tool for animals exposed to pathogens [PMC4990326]. In a study comparing positive and negative groups, it was found that the negative group had a higher number of counts for bta-mir-92a [PMC4990326]. High expression levels of bta-mir-92a have also been detected in skeletal muscle [PMC4410957]. Bta-mir-92a is one of the top 10 highly expressed miRNAs in various samples, indicating its abundance and potential importance [PMC4156418]. Furthermore, bta-mir-92a is one of the immune-related miRNAs that are highly expressed in cattle [PMC6940744]. In different studies, bta-mir-92a has been found to be misregulated in liver and tongue tissues [PMC6691986]. It has also been shown to be downregulated in extracellular vesicles secreted by arrested embryos but upregulated in competent embryos [PMC7727673]. Bta-mir-92a is co-detected with other miRNAs in 8-cell and blastocyst samples, suggesting its involvement in early embryonic development [PMC8060439]. Additionally, it is one of the immune-related miRNAs highly expressed in bovine samples [PMC7070426]. Bta-mir-92a has also been reported as highly expressed in blood exosomes of dairy cows [PMC9445238]. Overall, bta-mir-92a shows potential as a diagnostic tool and plays a role in various biological processes.
-cuuu ac c u uu cu acagguugggau ggu gcaaugcugug u || |||||||||||| ||| ||||||||||| ga UGUCCGGCCCUG UCA CGUUAUgguau c gguuu gu U - gu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Accession | MIMAT0009383 |
Description | Bos taurus bta-miR-92a mature miRNA |
Sequence | 48 - UAUUGCACUUGUCCCGGCCUGU - 69 |
Evidence |
experimental
cloned [2] |
|