Stem-loop sequence mmu-mir-1948

AccessionMI0009939 (change log)
Symbol MGI:Mir1948
DescriptionMus musculus miR-1948 stem-loop
Literature search

1 open access papers mention mmu-mir-1948
(1 sentences)

Stem-loop
                 a       a               gug 
5' auucucaccuuacu uaugagu uucugccuaaaugug   u
   |||||||||||||| ||||||| |||||||||||||||   a
3' uaagaguggaauga augcuca gagacggauuuacau   c
                 c       c               agg 
Get sequence
Deep sequencing
4760 reads, 0 reads per million, 81 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr18: 12714811-12714895 [+]
sense
OTTMUST00000090219 ; Ttc39c-004; intron 6
OTTMUST00000069821 ; Ttc39c-001; intron 6
ENSMUST00000169401 ; Ttc39c-004; intron 6
ENSMUST00000025294 ; Ttc39c-001; intron 6
Database links

Mature sequence mmu-miR-1948-5p

Accession MIMAT0017344
Previous IDsmmu-miR-1948*
Sequence

15 - 

auaugaguauucugccuaaau

 - 35

Get sequence
Deep sequencing228 reads, 37 experiments
Evidence experimental; 454 [2]
Database links
Predicted targets

Mature sequence mmu-miR-1948-3p

Accession MIMAT0009415
Previous IDsmmu-miR-1948
Sequence

52 - 

uuuaggcagagcacucguacag

 - 73

Get sequence
Deep sequencing4389 reads, 65 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).
2
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).