Stem-loop sequence mmu-mir-1966

AccessionMI0009963 (change log)
Symbol MGI:Mir1966
DescriptionMus musculus miR-1966 stem-loop
Stem-loop
   -- u    u      g  a   ---a   g   c   a      cc    au     c 
5'   g agaa aguguu ga ggg    gcu gcu agg gagagu  ugag  uuagg u
     | |||| |||||| || |||    ||| ||| ||| ||||||  ||||  ||||| c
3'   c ucuu ucgcaa uu ccu    uga cga ucc cucuca  acuc  agucu u
   ag u    -      g  a   gaac   a   u   -      --    --     u 
Get sequence
Deep sequencing
168 reads, 0 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 105615466-105615573 [+]
sense
ENSMUST00000043531 ; Fam65a-201; 3'UTR (exon 6)
Database links

Mature sequence mmu-miR-1966-5p

Accession MIMAT0009439
Previous IDsmmu-miR-1966
Sequence

16 - 

aagggagcuggcucaggagagaguc

 - 40

Get sequence
Deep sequencing102 reads, 36 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence mmu-miR-1966-3p

Accession MIMAT0022952
Sequence

56 - 

uuucugacucaacucucccuuag

 - 78

Get sequence
Deep sequencing66 reads, 26 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:18849523 "In-depth characterization of the microRNA transcriptome in a leukemia progression model" Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK Genome Res. 18:1787-1797(2008).