Stem-loop sequence gma-MIR2109

AccessionMI0010579 (change log)
DescriptionGlycine max miR2109 stem-loop
Gene family MIPF0001000; MIR2109
Literature search

10 open access papers mention gma-MIR2109
(20 sentences)

Stem-loop 
       c        u          ---a     acu 
5' ggug gagugucu cgccucugag    gagau   a
   |||| |||||||| ||||||||||    |||||    
3' ccac cucauaga gcggaggcuc    cucua   u
       a        u          cgaa     gag
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 36995886-36995956 [-]
intergenic
Database links

Mature sequence gma-miR2109-5p

Accession MIMAT0010086
Previous IDsgma-miR2109
Sequence

3 -  

ugcgagugucuucgccucug

 - 22

Get sequence
Evidence experimental; cloned [1], 454 [2], Illumina [3-4]

Mature sequence gma-miR2109-3p

Accession MIMAT0032101
Sequence

51 -  

ggaggcguagauacucacacc

 - 71

Get sequence
Evidence experimental; Illumina [5-6]

References

1
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
2
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
3
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).
4
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).
5
PMID:24475082 "Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons" Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ PLoS One. 9:e86153(2014).
6
PMID:25747880 "Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean" Zhao M, Meyers BC, Cai C, Xu W, Ma J Plant Cell. 27:546-562(2015).