Stem-loop sequence bta-mir-2418

AccessionMI0011464 (change log)
DescriptionBos taurus miR-2418 stem-loop
Literature search

1 open access papers mention bta-mir-2418
(1 sentences)

Stem-loop
     c     u     --     u            accu  u 
5' gg acaga gggau  gagug ggcguggucgag    gg c
   || ||||| |||||  ||||| ||||||||||||    ||  
3' uc ugucu cccug  cucgu cugugccaguuc    cc u
     -     u     cc     -            ----  g 
Get sequence
Deep sequencing
16 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr4: 49511668-49511743 [-]
sense
ENSBTAT00000015166 ; LAMB1-201; intron 12
Database links

Mature sequence bta-miR-2418

Accession MIMAT0011982
Sequence

9 - 

ugggaugaguguggcguggucg

 - 30

Get sequence
Deep sequencing15 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).