Stem-loop sequence dps-mir-2524

AccessionMI0011657 (change log)
DescriptionDrosophila pseudoobscura miR-2524 stem-loop
Stem-loop
   -      uauaguuu            gu  c   c   -   -     ga 
5'  gaguua        guaguuggcccg  uc cag aca ugu auguu  a
    ||||||        ||||||||||||  || ||| ||| ||| |||||   
3'  cucgau        uauuaaccgggc  ag guc ugu aua uauaa  u
   a      --------            uc  c   a   u   c     au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 8376659-8376751 [-]
intergenic
XL_group1e: 8377507-8377599 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2524
dps-mir-2543b-1XL_group1e: 8380575-8380690 [-]
dps-mir-2517-3XL_group1e: 8380430-8380532 [-]
dps-mir-2544XL_group1e: 8378925-8379029 [-]
dps-mir-2542-3XL_group1e: 8378579-8378663 [-]
dps-mir-2543b-2XL_group1e: 8378173-8378288 [-]
dps-mir-2517-2XL_group1e: 8378028-8378132 [-]
dps-mir-2524XL_group1e: 8377507-8377599 [-]
dps-mir-2542-2XL_group1e: 8376961-8377045 [-]
dps-mir-2524XL_group1e: 8376659-8376751 [-]
dps-mir-2543a-2XL_group1e: 8373978-8374093 [-]
dps-mir-2542-1XL_group1e: 8373614-8373698 [-]
dps-mir-2541XL_group1e: 8367679-8367786 [-]
dps-mir-2540XL_group1e: 8367333-8367441 [-]
dps-mir-2523XL_group1e: 8366995-8367108 [-]
dps-mir-2539XL_group1e: 8366678-8366788 [-]
Database links

Mature sequence dps-miR-2524

Accession MIMAT0012312
Sequence

60 - 

uauuguacugcgacucgggcca

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).