Stem-loop sequence dps-mir-2526

AccessionMI0011659 (change log)
DescriptionDrosophila pseudoobscura miR-2526 stem-loop
Stem-loop
        gg ug   u          -   ug ua    u           -   g 
5' gcggu  u  ccg cggcguguug cgg  g  gccg cggcguguuga ggu g
   |||||  |  ||| |||||||||| |||  |  |||| ||||||||||| |||  
3' ugccg  g  ggc guugugcggc gcc  u  uggc guugugcggcu ccg u
        uu gu   -          u   gu gg    -           g   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1a: 7530704-7530809 [+]
intergenic
Database links

Mature sequence dps-miR-2526-3p

Accession MIMAT0012315
Previous IDsdps-miR-2526
Sequence

79 - 

gccgucggcguguugcggug

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).