Stem-loop sequence dps-mir-2536

AccessionMI0011670 (change log)
DescriptionDrosophila pseudoobscura miR-2536 stem-loop
Stem-loop
   -     -   u     a aacug   g  c  u     u   uu    c   u  gug 
5'  gugau uuc agaga g     gca ug aa acguu uuc  cgca uga gu   u
    ||||| ||| ||||| |     ||| || || ||||| |||  |||| ||| ||    
3'  cgcua gag ucuuu c     ugu ac uu ugcaa aag  gcgu acu ca   u
   c     c   -     g ----g   g  a  u     u   uu    a   c  aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 8362342-8362452 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2536
dps-mir-2541XL_group1e: 8367679-8367786 [-]
dps-mir-2540XL_group1e: 8367333-8367441 [-]
dps-mir-2523XL_group1e: 8366995-8367108 [-]
dps-mir-2539XL_group1e: 8366678-8366788 [-]
dps-mir-2522aXL_group1e: 8365900-8366011 [-]
dps-mir-2522bXL_group1e: 8363413-8363514 [-]
dps-mir-2538XL_group1e: 8363244-8363359 [-]
dps-mir-2521XL_group1e: 8362756-8362842 [-]
dps-mir-2520XL_group1e: 8362599-8362718 [-]
dps-mir-2537XL_group1e: 8362508-8362587 [-]
dps-mir-2536XL_group1e: 8362342-8362452 [-]
Database links

Mature sequence dps-miR-2536-5p

Accession MIMAT0012326
Previous IDsdps-miR-2536
Sequence

29 - 

aauacguuuuucuucgcacuga

 - 50

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2536-3p

Accession MIMAT0012327
Previous IDsdps-miR-2536*
Sequence

67 - 

aaugcguugaauaacguuuuac

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).