Stem-loop sequence dps-mir-2537

AccessionMI0011671 (change log)
DescriptionDrosophila pseudoobscura miR-2537 stem-loop
Stem-loop
   -    uau ua     c      c  u    a   uucu 
5'  gauu   g  gcuaa ggacaa cg cuau uug    a
    ||||   |  ||||| |||||| || |||| |||    a
3'  cuag   c  cgauu ccuguu gc gaua aac    a
   c    cgu gc     u      c  u    a   cuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 8362508-8362587 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2537
dps-mir-2541XL_group1e: 8367679-8367786 [-]
dps-mir-2540XL_group1e: 8367333-8367441 [-]
dps-mir-2523XL_group1e: 8366995-8367108 [-]
dps-mir-2539XL_group1e: 8366678-8366788 [-]
dps-mir-2522aXL_group1e: 8365900-8366011 [-]
dps-mir-2522bXL_group1e: 8363413-8363514 [-]
dps-mir-2538XL_group1e: 8363244-8363359 [-]
dps-mir-2521XL_group1e: 8362756-8362842 [-]
dps-mir-2520XL_group1e: 8362599-8362718 [-]
dps-mir-2537XL_group1e: 8362508-8362587 [-]
dps-mir-2536XL_group1e: 8362342-8362452 [-]
Database links

Mature sequence dps-miR-2537-5p

Accession MIMAT0012328
Previous IDsdps-miR-2537*
Sequence

13 - 

uaacggacaaccgucuauauug

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2537-3p

Accession MIMAT0012329
Previous IDsdps-miR-2537
Sequence

48 - 

aaauagucgcuuguccuuuagc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).