Stem-loop sequence dps-mir-2522b

AccessionMI0011673 (change log)
DescriptionDrosophila pseudoobscura miR-2522b stem-loop
Stem-loop
         ucuac   c aa   auuu cg       g     g    u  au 
5' guguuu     gau g  gua    c  ggaaugc cuguu uugg gu  u
   ||||||     ||| |  |||    |  ||||||| ||||| |||| ||  c
3' uacgag     cua c  cau    g  ucuuacg gacga gacc ua  g
         --caa   c gc   cacu cu       a     -    u  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 8363413-8363514 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2522b
dps-mir-2541XL_group1e: 8367679-8367786 [-]
dps-mir-2540XL_group1e: 8367333-8367441 [-]
dps-mir-2523XL_group1e: 8366995-8367108 [-]
dps-mir-2539XL_group1e: 8366678-8366788 [-]
dps-mir-2522aXL_group1e: 8365900-8366011 [-]
dps-mir-2522bXL_group1e: 8363413-8363514 [-]
dps-mir-2538XL_group1e: 8363244-8363359 [-]
dps-mir-2521XL_group1e: 8362756-8362842 [-]
dps-mir-2520XL_group1e: 8362599-8362718 [-]
dps-mir-2537XL_group1e: 8362508-8362587 [-]
dps-mir-2536XL_group1e: 8362342-8362452 [-]
Database links

Mature sequence dps-miR-2522b-5p

Accession MIMAT0012332
Previous IDsdps-miR-2522b
Sequence

24 - 

uuccgggaaugcgcuguuguugg

 - 46

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2522b-3p

Accession MIMAT0012333
Previous IDsdps-miR-2522b*
Sequence

62 - 

agagcagagcauucuucguca

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).