Stem-loop sequence dps-mir-2539

Accession

MI0011674 (change log)

Description

Drosophila pseudoobscura miR-2539 stem-loop

Stem-loop

       guuuuccc     ug c   a              uu         -   a 
5' cacu        cugau  a ggu gugaauggucaugu  cuguauugg ugu u
   ||||        |||||  | ||| ||||||||||||||  ||||||||| ||| u
3' guga        gacua  u uca cacuuauuaguacg  gacauaacc aua c
       aauuauac     gu -   a              cc         u   g 

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (dpse_r2.26_FB2012_01): XL_group1e: 8366678-8366788 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from dps-mir-2539

• dps-mir-2524: XL_group1e: 8377507-8377599 [-]
• dps-mir-2524: XL_group1e: 8376659-8376751 [-]
• dps-mir-2543a-2: XL_group1e: 8373978-8374093 [-]
• dps-mir-2542-1: XL_group1e: 8373614-8373698 [-]
• dps-mir-2541: XL_group1e: 8367679-8367786 [-]
• dps-mir-2540: XL_group1e: 8367333-8367441 [-]
• dps-mir-2523: XL_group1e: 8366995-8367108 [-]
• dps-mir-2539: XL_group1e: 8366678-8366788 [-]
• dps-mir-2522a: XL_group1e: 8365900-8366011 [-]
• dps-mir-2522b: XL_group1e: 8363413-8363514 [-]
• dps-mir-2538: XL_group1e: 8363244-8363359 [-]
• dps-mir-2521: XL_group1e: 8362756-8362842 [-]
• dps-mir-2520: XL_group1e: 8362599-8362718 [-]
• dps-mir-2537: XL_group1e: 8362508-8362587 [-]
• dps-mir-2536: XL_group1e: 8362342-8362452 [-]

Database links

• miRBase Tracker:MI0011674

Mature sequence dps-miR-2539-5p

• Accession: MIMAT0012334
• Previous IDs: dps-miR-2539
• Sequence: 29 - aauggucauguuucuguauug - 49
• Evidence: experimental; Illumina [1]

Mature sequence dps-miR-2539-3p

• Accession: MIMAT0012335
• Previous IDs: dps-miR-2539*
• Sequence: 65 - aauacagccgcaugauuauuca - 86
• Evidence: experimental; Illumina [1]

References

1. PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).