Stem-loop sequence dps-mir-2543b-2

AccessionMI0011682 (change log)
DescriptionDrosophila pseudoobscura miR-2543b-2 stem-loop
Gene family MIPF0000856; mir-2543
Stem-loop
   -  ug -cag  ag      -     -------ua      g         u    uacaau  g 
5'  cc  c    ag  ggcuuu ugguu         uccuau ugcuguggc uaug      uc a
    ||  |    ||  |||||| |||||         |||||| ||||||||| ||||      ||  
3'  gg  g    uc  ccgaaa accga         aggaua gcggcaccg auac      ag a
   a  gu ccua  aa      c     uuacuaacg      g         u    ------  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 8378173-8378288 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2543b-2
dps-mir-2543b-1XL_group1e: 8380575-8380690 [-]
dps-mir-2517-3XL_group1e: 8380430-8380532 [-]
dps-mir-2544XL_group1e: 8378925-8379029 [-]
dps-mir-2542-3XL_group1e: 8378579-8378663 [-]
dps-mir-2543b-2XL_group1e: 8378173-8378288 [-]
dps-mir-2517-2XL_group1e: 8378028-8378132 [-]
dps-mir-2524XL_group1e: 8377507-8377599 [-]
dps-mir-2542-2XL_group1e: 8376961-8377045 [-]
dps-mir-2524XL_group1e: 8376659-8376751 [-]
dps-mir-2543a-2XL_group1e: 8373978-8374093 [-]
dps-mir-2542-1XL_group1e: 8373614-8373698 [-]
Database links

Mature sequence dps-miR-2543b-5p

Accession MIMAT0012346
Previous IDsdps-miR-2543b*
Sequence

25 - 

auccuaugugcuguggcuuaug

 - 46

Get sequence
Evidence experimental; Illumina [1]

Mature sequence dps-miR-2543b-3p

Accession MIMAT0012347
Previous IDsdps-miR-2543b
Sequence

63 - 

uaugccacggcggauaggagca

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).