Stem-loop sequence dps-mir-2517-3

AccessionMI0011725 (change log)
DescriptionDrosophila pseudoobscura miR-2517-3 stem-loop
Gene family MIPF0000839; mir-2517
Stem-loop
        ---aaa    cc               -      a c     uauuau 
5' gggug      uggu  agaguuuucagaucc ucaaau c auaug      u
   |||||      ||||  ||||||||||||||| |||||| | |||||       
3' ccuac      acca  uuucaaaaguuuagg gguuua g uauac      u
        auauac    cu               u      - u     uuucag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (dpse_r2.26_FB2012_01) Overlapping transcripts
XL_group1e: 8380430-8380532 [-]
intergenic
Clustered miRNAs
< 10kb from dps-mir-2517-3
dps-mir-2543b-1XL_group1e: 8380575-8380690 [-]
dps-mir-2517-3XL_group1e: 8380430-8380532 [-]
dps-mir-2544XL_group1e: 8378925-8379029 [-]
dps-mir-2542-3XL_group1e: 8378579-8378663 [-]
dps-mir-2543b-2XL_group1e: 8378173-8378288 [-]
dps-mir-2517-2XL_group1e: 8378028-8378132 [-]
dps-mir-2524XL_group1e: 8377507-8377599 [-]
dps-mir-2542-2XL_group1e: 8376961-8377045 [-]
dps-mir-2524XL_group1e: 8376659-8376751 [-]
dps-mir-2543a-2XL_group1e: 8373978-8374093 [-]
dps-mir-2542-1XL_group1e: 8373614-8373698 [-]
Database links

Mature sequence dps-miR-2517-3p

Accession MIMAT0012343
Previous IDsdps-miR-2517a
Sequence

60 - 

uauugauuugguggauuugaaaa

 - 82

Get sequence
Evidence experimental; Illumina [1]

Minor miR* sequence dps-miR-2517a*

Accession MIMAT0012342
Sequence

21 - 

uucagauccucaaauaccauaug

 - 43

Get sequence
Evidence experimental;

References

1
PMID:20037610 "Evolutionary flux of canonical microRNAs and mirtrons in Drosophila" Berezikov E, Liu N, Flynt AS, Hodges E, Rooks M, Hannon GJ, Lai EC Nat Genet. 42:6-9(2010).