![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ssc-mir-365-1 |
|||||
Accession | MI0013121 (change log) | ||||
Description | Sus scrofa miR-365-1 stem-loop | ||||
Gene family | MIPF0000061; mir-365 | ||||
Literature search |
![]()
7 open access papers mention ssc-mir-365-1 | ||||
Stem-loop |
-c ggaaaaug c ---- - uuu 5' gcag aggga uuuugggggca gau gug c |||| ||||| ||||||||||| ||| ||| c 3' cguu uuccu aaaauccccgu cua cac a cu -------a a aaua u cuu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence ssc-miR-365-3p |
|
Accession | MIMAT0013904 |
Previous IDs | ssc-miR-365 |
Sequence |
54 - uaaugccccuaaaaauccuuau - 75 |
Deep sequencing | 815 reads, 15 experiments |
Evidence | experimental; Illumina [1-4] |
References |
|
1 |
PMID:19917043
"MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
Anim Genet. 41:159-168(2010).
|
2 |
PMID:20433717
"Deciphering the porcine intestinal microRNA transcriptome"
BMC Genomics. 11:275(2010).
|
3 |
PMID:21312241
"MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing"
J Cell Biochem. 112:1318-1328(2011).
|
4 |
PMID:24499489
"Exploration of microRNAs in porcine milk exosomes"
BMC Genomics. 15:100(2014).
|