![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-275 |
||||||
Accession | MI0013434 (change log) | |||||
Description | Aedes aegypti miR-275 stem-loop | |||||
Gene family | MIPF0000187; mir-275 | |||||
Literature search |
![]()
5 open access papers mention aae-mir-275 | |||||
Stem-loop |
auccuuuc u -ag a ga - u a 5' gauu cgcgcgcua cagg acc gacu uug c u |||| ||||||||| |||| ||| |||| ||| | 3' cuag gcgcgcgau gucc ugg cuga gau g u -------- u gaa a -a c c u |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence aae-miR-275-5p |
|
Accession | MIMAT0014208 |
Previous IDs | aae-miR-275* |
Sequence |
16 - cgcgcuaagcaggaaccgagac - 37 |
Deep sequencing | 2928 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
Mature sequence aae-miR-275-3p |
|
Accession | MIMAT0014209 |
Previous IDs | aae-miR-275 |
Sequence |
56 - ucagguaccugaaguagcgc - 75 |
Deep sequencing | 698100 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|