Stem-loop sequence aae-mir-275

AccessionMI0013434 (change log)
DescriptionAedes aegypti miR-275 stem-loop
Gene family MIPF0000187; mir-275
Literature search

5 open access papers mention aae-mir-275
(134 sentences)

Stem-loop 
   auccuuuc    u         -ag    a   ga    -   u a 
5'         gauu cgcgcgcua   cagg acc  gacu uug c u
           |||| |||||||||   |||| |||  |||| ||| |  
3'         cuag gcgcgcgau   gucc ugg  cuga gau g u
   --------    u         gaa    a   -a    c   c u
Get sequence
Deep sequencing
701028 reads, 3.58e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.24: 486536-486618 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-275
aae-mir-275supercont1.24: 486536-486618 [+]
aae-mir-305supercont1.24: 495587-495674 [+]
Database links

Mature sequence aae-miR-275-5p

Accession MIMAT0014208
Previous IDsaae-miR-275*
Sequence

16 -  

cgcgcuaagcaggaaccgagac

 - 37

Get sequence
Deep sequencing2928 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-275-3p

Accession MIMAT0014209
Previous IDsaae-miR-275
Sequence

56 -  

ucagguaccugaaguagcgc

 - 75

Get sequence
Deep sequencing698100 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).