![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-8 |
|||||
Accession | MI0013437 (change log) | ||||
Description | Aedes aegypti miR-8 stem-loop | ||||
Gene family | MIPF0000019; mir-8 | ||||
Literature search |
3 open access papers mention aae-mir-8 | ||||
Stem-loop |
gucu ----- - g c -- u 5' guuc acaucuu acc ggcag auuaga uauu u |||| ||||||| ||| ||||| |||||| |||| u 3' caag uguagaa ugg cuguc uaaucu auaa g ---- ccugc a a a uc a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-miR-8-5p |
|
Accession | MIMAT0014214 |
Previous IDs | aae-miR-8* |
Sequence |
10 - caucuuaccgggcagcauuaga - 31 |
Deep sequencing | 75201 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
Mature sequence aae-miR-8-3p |
|
Accession | MIMAT0014215 |
Previous IDs | aae-miR-8 |
Sequence |
49 - uaauacugucagguaaagauguc - 71 |
Deep sequencing | 145919 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|