Stem-loop sequence aae-mir-8

Accession

MI0013437 (change log)

Description

Aedes aegypti miR-8 stem-loop

Gene family

MIPF0000019; mir-8

Literature search

3 open access papers mention aae-mir-8
(4 sentences)

Stem-loop

   gucu    -----       -   g     c      --    u 
5'     guuc     acaucuu acc ggcag auuaga  uauu u
       ||||     ||||||| ||| ||||| ||||||  |||| u
3'     caag     uguagaa ugg cuguc uaaucu  auaa g
   ----    ccugc       a   a     a      uc    a 

Deep sequencing

221120 reads, 1.07e+04 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.411: 876043-876121 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0013437

Mature sequence aae-miR-8-5p

• Accession: MIMAT0014214
• Previous IDs: aae-miR-8*
• Sequence: 10 - caucuuaccgggcagcauuaga - 31
• Deep sequencing: 75201 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-8-3p

• Accession: MIMAT0014215
• Previous IDs: aae-miR-8
• Sequence: 49 - uaauacugucagguaaagauguc - 71
• Deep sequencing: 145919 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).