![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-bantam |
|||||
Accession | MI0013439 (change log) | ||||
Description | Aedes aegypti bantam stem-loop | ||||
Gene family | MIPF0000153; bantam | ||||
Literature search |
3 open access papers mention aae-bantam | ||||
Stem-loop |
agaac uuuuc g au au 5' cgguuuuca gaucu acuu uug u ||||||||| ||||| |||| ||| 3' gucgaaagu cuaga ugag aac u uuuua -uuua g -- aa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-bantam-5p |
|
Accession | MIMAT0014218 |
Sequence |
5 - ccgguuuucauuuucgaucugac - 27 |
Deep sequencing | 2107 reads, 2 experiments |
Evidence | experimental; Illumina [2] |
Mature sequence aae-bantam-3p |
|
Accession | MIMAT0014219 |
Sequence |
47 - ugagaucauuuugaaagcugau - 68 |
Deep sequencing | 48412 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|