Stem-loop sequence aae-bantam

AccessionMI0013439 (change log)
DescriptionAedes aegypti bantam stem-loop
Gene family MIPF0000153; bantam
Literature search

3 open access papers mention aae-bantam
(6 sentences)

Stem-loop 
   agaac         uuuuc     g    au   au 
5'      cgguuuuca     gaucu acuu  uug  u
        |||||||||     ||||| ||||  |||   
3'      gucgaaagu     cuaga ugag  aac  u
   uuuua         -uuua     g    --   aa
Get sequence
Deep sequencing
50520 reads, 2.55e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.49: 1579552-1579622 [-]
intergenic
Database links

Mature sequence aae-bantam-5p

Accession MIMAT0014218
Sequence

5 -  

ccgguuuucauuuucgaucugac

 - 27

Get sequence
Deep sequencing2107 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence aae-bantam-3p

Accession MIMAT0014219
Sequence

47 -  

ugagaucauuuugaaagcugau

 - 68

Get sequence
Deep sequencing48412 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).