Stem-loop sequence aae-mir-276-1

AccessionMI0013441 (change log)
DescriptionAedes aegypti miR-276-1 stem-loop
Gene family MIPF0000124; mir-276
Literature search

2 open access papers mention aae-mir-276-1
(5 sentences)

Stem-loop
   -acu   gauu    uc    a     ag         ----g    g 
5'     ggu    gcca  agcg gguau  aguuccuac     uugc u
       |||    ||||  |||| |||||  |||||||||     ||||  
3'     ccg    cggu  ucgu ccaua  ucaaggaug     agcg g
   agug   --au    uc    g     cu         guuaa    u 
Get sequence
Deep sequencing
722004 reads, 3.56e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.134: 38970-39060 [+]
intergenic
Database links

Mature sequence aae-miR-276-5p

Accession MIMAT0014222
Previous IDsaae-miR-276*
Sequence

17 - 

agcgagguauagaguuccuac

 - 37

Get sequence
Deep sequencing129371 reads, 2 experiments
Evidence experimental; 454 [1]

Mature sequence aae-miR-276-3p

Accession MIMAT0014223
Previous IDsaae-miR-276
Sequence

57 - 

uaggaacuucauaccgugcuc

 - 77

Get sequence
Deep sequencing1185313 reads, 2 experiments
Evidence experimental; 454 [1]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).