Stem-loop sequence aae-mir-92a

Accession

MI0013445 (change log)

Description

Aedes aegypti miR-92a stem-loop

Gene family

MIPF0000013; mir-25

Literature search

1 open access papers mention aae-mir-92a
(8 sentences)

Stem-loop

   aa         c   ac       g    c   -  -ga a 
5'   ucuacgcau ggu  ggacagg gcaa auu gu   c u
     ||||||||| |||  ||||||| |||| ||| ||   |  
3'   aggugcgua ccg  ccuguuc cguu uaa cg   g u
   ug         u   gc       a    a   u  aaa u 

Deep sequencing

20028 reads, 950 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.116: 1267202-1267283 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0013445

Mature sequence aae-miR-92a-5p

• Accession: MIMAT0015369
• Previous IDs: aae-miR-92a*
• Sequence: 12 - cgguacggacaggggcaacauu - 33
• Deep sequencing: 2110 reads, 2 experiments
• Evidence: experimental; 454 [1]

Mature sequence aae-miR-92a-3p

• Accession: MIMAT0014228
• Previous IDs: aae-miR-92a
• Sequence: 52 - uauugcacuugucccggccua - 72
• Deep sequencing: 17917 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).