![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-92a |
|||||
Accession | MI0013445 (change log) | ||||
Description | Aedes aegypti miR-92a stem-loop | ||||
Gene family | MIPF0000013; mir-25 | ||||
Literature search |
1 open access papers mention aae-mir-92a | ||||
Stem-loop |
aa c ac g c - -ga a 5' ucuacgcau ggu ggacagg gcaa auu gu c u ||||||||| ||| ||||||| |||| ||| || | 3' aggugcgua ccg ccuguuc cguu uaa cg g u ug u gc a a u aaa u |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-miR-92a-5p |
|
Accession | MIMAT0015369 |
Previous IDs | aae-miR-92a* |
Sequence |
12 - cgguacggacaggggcaacauu - 33 |
Deep sequencing | 2110 reads, 2 experiments |
Evidence | experimental; 454 [1] |
Mature sequence aae-miR-92a-3p |
|
Accession | MIMAT0014228 |
Previous IDs | aae-miR-92a |
Sequence |
52 - uauugcacuugucccggccua - 72 |
Deep sequencing | 17917 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|