![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-281 |
|||||
Accession | MI0013447 (change log) | ||||
Description | Aedes aegypti miR-281 stem-loop | ||||
Gene family | MIPF0000087; mir-46 | ||||
Literature search |
5 open access papers mention aae-mir-281 | ||||
Stem-loop |
u -uu a aaa -ua c ag ga 5' gg ucgaau ug auaaagagagc uccgu gacagu g u || |||||| || ||||||||||| ||||| |||||| | a 3' cu agcuua ac uauuucucucg aggua cuguca u u a uau - aug uua - cu ag |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-miR-281-5p |
|
Accession | MIMAT0014231 |
Previous IDs | aae-miR-281 |
Sequence |
21 - aagagagcuauccgucgac - 39 |
Deep sequencing | 27467 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
Mature sequence aae-miR-281-3p |
|
Accession | MIMAT0014232 |
Previous IDs | aae-miR-281* |
Sequence |
58 - ugucauggaauugcucucuuua - 79 |
Deep sequencing | 114 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|