Stem-loop sequence aae-mir-281

Accession

MI0013447 (change log)

Description

Aedes aegypti miR-281 stem-loop

Gene family

MIPF0000087; mir-46

Literature search

5 open access papers mention aae-mir-281
(8 sentences)

Stem-loop

   u  -uu      a  aaa           -ua     c      ag ga 
5'  gg   ucgaau ug   auaaagagagc   uccgu gacagu  g  u
    ||   |||||| ||   |||||||||||   ||||| ||||||  |  a
3'  cu   agcuua ac   uauuucucucg   aggua cuguca  u  u
   a  uau      -  aug           uua     -      cu ag 

Deep sequencing

27581 reads, 1.25e+03 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.957: 134442-134538 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0013447

Mature sequence aae-miR-281-5p

• Accession: MIMAT0014231
• Previous IDs: aae-miR-281
• Sequence: 21 - aagagagcuauccgucgac - 39
• Deep sequencing: 27467 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-281-3p

• Accession: MIMAT0014232
• Previous IDs: aae-miR-281*
• Sequence: 58 - ugucauggaauugcucucuuua - 79
• Deep sequencing: 114 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).