![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-1889 |
||||||||
Accession | MI0013448 (change log) | |||||||
Description | Aedes aegypti miR-1889 stem-loop | |||||||
Gene family | MIPF0000954; mir-1889 | |||||||
Literature search |
![]()
3 open access papers mention aae-mir-1889 | |||||||
Stem-loop |
ga u a a ugauuuuccuggugaaucccggccuuguccuccgu 5' gg aaucucaa uuguaac gugggu c || |||||||| ||||||| |||||| a 3' cc uugggguu gacauug caccca c cc u a - uaucgcuugugcaaaagcucugugaacagugugaa |
|||||||
Deep sequencing |
| |||||||
Confidence |
Annotation confidence: high
| |||||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
|||||||
Genome context |
|
|||||||
Clustered miRNAs |
|
|||||||
Database links |
|
Mature sequence aae-miR-1889-5p |
|
Accession | MIMAT0014233 |
Previous IDs | aae-miR-1889* |
Sequence |
5 - uaaucucaaauuguaacagugg - 26 |
Deep sequencing | 1380 reads, 2 experiments |
Evidence | experimental; Illumina [2] |
Mature sequence aae-miR-1889-3p |
|
Accession | MIMAT0014234 |
Previous IDs | aae-miR-1889 |
Sequence |
105 - cacguuacagauugggguuucc - 126 |
Deep sequencing | 1411 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|