Stem-loop sequence aae-mir-1889

Accession

MI0013448 (change log)

Description

Aedes aegypti miR-1889 stem-loop

Gene family

MIPF0000954; mir-1889

Literature search

3 open access papers mention aae-mir-1889
(14 sentences)

Stem-loop

   ga  u        a       a      ugauuuuccuggugaaucccggccuuguccuccgu 
5'   gg aaucucaa uuguaac gugggu                                   c
     || |||||||| ||||||| ||||||                                   a
3'   cc uugggguu gacauug caccca                                   c
   cc  u        a       -      uaucgcuugugcaaaagcucugugaacagugugaa 

Deep sequencing

2791 reads, 50 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.68: 2720794-2720921 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from aae-mir-1889

• aae-mir-283: supercont1.68: 2729329-2729431 [-]
• aae-mir-1889: supercont1.68: 2720794-2720921 [-]
• aae-mir-12: supercont1.68: 2720396-2720497 [-]

Database links

• miRBase Tracker:MI0013448

Mature sequence aae-miR-1889-5p

• Accession: MIMAT0014233
• Previous IDs: aae-miR-1889*
• Sequence: 5 - uaaucucaaauuguaacagugg - 26
• Deep sequencing: 1380 reads, 2 experiments
• Evidence: experimental; Illumina [2]

Mature sequence aae-miR-1889-3p

• Accession: MIMAT0014234
• Previous IDs: aae-miR-1889
• Sequence: 105 - cacguuacagauugggguuucc - 126
• Deep sequencing: 1411 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).