Stem-loop sequence aae-mir-278

Accession

MI0013450 (change log)

Description

Aedes aegypti miR-278 stem-loop

Gene family

MIPF0000155; mir-278

Literature search

2 open access papers mention aae-mir-278
(4 sentences)

Stem-loop

   --u   -            u     u  g      -ug auu 
5'    ggu gcgaacggacga agucu ca cggccg   c   u
      ||| |||||||||||| ||||| || ||||||   |    
3'    cca uguuugccugcu ucagg gu gcuggu   g   g
   ccg   a            u     -  g      uaa aua 

Deep sequencing

2501 reads, 100 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.16: 3596261-3596341 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0013450

Mature sequence aae-miR-278-5p

• Accession: MIMAT0014237
• Previous IDs: aae-miR-278
• Sequence: 9 - acggacgauagucuucagcggcc - 31
• Deep sequencing: 445 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-278-3p

• Accession: MIMAT0014238
• Previous IDs: aae-miR-278*
• Sequence: 51 - ucggugggacuuucguccguuu - 72
• Deep sequencing: 2053 reads, 2 experiments
• Evidence: experimental; Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).