![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-278 |
|||||
Accession | MI0013450 (change log) | ||||
Description | Aedes aegypti miR-278 stem-loop | ||||
Gene family | MIPF0000155; mir-278 | ||||
Literature search |
2 open access papers mention aae-mir-278 | ||||
Stem-loop |
--u - u u g -ug auu 5' ggu gcgaacggacga agucu ca cggccg c u ||| |||||||||||| ||||| || |||||| | 3' cca uguuugccugcu ucagg gu gcuggu g g ccg a u - g uaa aua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-miR-278-5p |
|
Accession | MIMAT0014237 |
Previous IDs | aae-miR-278 |
Sequence |
9 - acggacgauagucuucagcggcc - 31 |
Deep sequencing | 445 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
Mature sequence aae-miR-278-3p |
|
Accession | MIMAT0014238 |
Previous IDs | aae-miR-278* |
Sequence |
51 - ucggugggacuuucguccguuu - 72 |
Deep sequencing | 2053 reads, 2 experiments |
Evidence | experimental; Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|