Stem-loop sequence aae-mir-989

AccessionMI0013451 (change log)
DescriptionAedes aegypti miR-989 stem-loop
Gene family MIPF0000885; mir-989
Literature search

7 open access papers mention aae-mir-989
(31 sentences)

Stem-loop 
   -----uucaucauac     u      -cc        c    uu    u   uaccgau 
5'                gguca ggggga   gccgcuac ucgc  ucac ugg       u
                  ||||| ||||||   |||||||| ||||  |||| |||       u
3'                ucggu ucccuu   uggugaug agug  agug acc       c
   uccuucacaacauua     -      cca        c    -u    u   uaauacc
Get sequence
Deep sequencing
194 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.115: 804160-804274 [-]
intergenic
Database links

Mature sequence aae-miR-989

Accession MIMAT0014239
Sequence

68 -  

ugugaugugacguagugguac

 - 88

Get sequence
Deep sequencing193 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).