Stem-loop sequence aae-mir-11

Accession

MI0013453 (change log)

Description

Aedes aegypti miR-11 stem-loop

Gene family

MIPF0000252; mir-11

Literature search

4 open access papers mention aae-mir-11
(7 sentences)

Stem-loop

   ----aaca     --      agug   c          c        cc    uacacuu 
5'         uugau  gcgagu    ccg gcgagaacuc ggcuguga  ugug       u
           |||||  ||||||    ||| |||||||||| ||||||||  ||||        
3'         aacua  ugcucg    ggu cguucuugag cugacacu  acac       a
   agguaauc     gc      --ga   u          u        --    uaaaccu 

Deep sequencing

30277 reads, 1.4e+03 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.744: 321996-322109 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from aae-mir-11

• aae-mir-11: supercont1.744: 321996-322109 [+]
• aae-mir-998: supercont1.744: 322280-322371 [+]

Database links

• miRBase Tracker:MI0013453

Mature sequence aae-miR-11-5p

• Accession: MIMAT0014241
• Previous IDs: aae-miR-11*
• Sequence: 27 - agaacuccggcugugaccugug - 48
• Deep sequencing: 2428 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-11-3p

• Accession: MIMAT0014242
• Previous IDs: aae-miR-11
• Sequence: 67 - caucacagucugaguucuugcu - 88
• Deep sequencing: 27849 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).