![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-11 |
||||||
Accession | MI0013453 (change log) | |||||
Description | Aedes aegypti miR-11 stem-loop | |||||
Gene family | MIPF0000252; mir-11 | |||||
Literature search |
4 open access papers mention aae-mir-11 | |||||
Stem-loop |
----aaca -- agug c c cc uacacuu 5' uugau gcgagu ccg gcgagaacuc ggcuguga ugug u ||||| |||||| ||| |||||||||| |||||||| |||| 3' aacua ugcucg ggu cguucuugag cugacacu acac a agguaauc gc --ga u u -- uaaaccu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence aae-miR-11-5p |
|
Accession | MIMAT0014241 |
Previous IDs | aae-miR-11* |
Sequence |
27 - agaacuccggcugugaccugug - 48 |
Deep sequencing | 2428 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
Mature sequence aae-miR-11-3p |
|
Accession | MIMAT0014242 |
Previous IDs | aae-miR-11 |
Sequence |
67 - caucacagucugaguucuugcu - 88 |
Deep sequencing | 27849 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|