Stem-loop sequence aae-mir-1890

AccessionMI0013457 (change log)
DescriptionAedes aegypti miR-1890 stem-loop
Gene family MIPF0000848; mir-1890
Literature search

4 open access papers mention aae-mir-1890
(7 sentences)

Stem-loop
   aucg  a          g     ug    g   u    ua  gu 
5'     ac uacggcuaga cuaau  gaga uuc ugaa  gu  u
       || |||||||||| |||||  |||| ||| ||||  ||  g
3'     ug gugcuggucu gauua  uucu aag acuu  ca  u
   ---g  -          g     gu    a   u    -c  ag 
Get sequence
Deep sequencing
3376 reads, 150 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.204: 1733300-1733385 [+]
intergenic
Database links

Mature sequence aae-miR-1890

Accession MIMAT0014247
Sequence

57 - 

ugaaaucuuugauuaggucugg

 - 78

Get sequence
Deep sequencing3263 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).