Stem-loop sequence aae-mir-999

AccessionMI0013464 (change log)
DescriptionAedes aegypti miR-999 stem-loop
Gene family MIPF0000852; mir-999
Literature search

1 open access papers mention aae-mir-999
(1 sentences)

Stem-loop 
   --------              g     ga   u      cau 
5'         gcagggacgcgguc ugcag  aau auuugg   u
           |||||||||||||| |||||  ||| ||||||    
3'         cguuucugugucag auguc  uug uaaacu   a
   cuaguggg              a     aa   -      uag
Get sequence
Deep sequencing
28498 reads, 1.3e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.100: 2315100-2315178 [+]
intergenic
Database links

Mature sequence aae-miR-999

Accession MIMAT0014257
Sequence

46 -  

uguuaacuguaagacugugucu

 - 67

Get sequence
Deep sequencing26258 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).