Stem-loop sequence aae-mir-1891-2

AccessionMI0013469 (change log)
DescriptionAedes aegypti miR-1891-2 stem-loop
Gene family MIPF0000857; mir-1891
Literature search

2 open access papers mention aae-mir-1891-2
(5 sentences)

Stem-loop 
   --au     uc        uga         uu        uugua 
5'     cuuuu  cgucaugu   ggaguuaau  gcguguuu     u
       |||||  ||||||||   |||||||||  ||||||||      
3'     gaaaa  guaguaca   ucucaauua  ugcacaaa     u
   aacc     ua        ugg         cc        uuagu
Get sequence
Deep sequencing
28773 reads, 1.4e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.466: 72785-72876 [+]
intergenic
Database links

Mature sequence aae-miR-1891

Accession MIMAT0014263
Sequence

18 -  

ugaggaguuaauuugcguguuu

 - 39

Get sequence
Deep sequencing56214 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).