Stem-loop sequence aae-mir-1175

AccessionMI0013470 (change log)
DescriptionAedes aegypti miR-1175 stem-loop
Gene family MIPF0000715; mir-1175
Literature search

5 open access papers mention aae-mir-1175
(23 sentences)

Stem-loop 
   ac        a     -    u     uc  a      agua 
5'   gauaugaa uaagu ggag agugg  uc ucgcuu    u
     |||||||| ||||| |||| |||||  || ||||||     
3'   cuauacuu auuca ccuc ucauc  ag agugaa    u
   au        a     g    u     uu  -      aaga
Get sequence
Deep sequencing
71 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.125: 1648025-1648108 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-1175
aae-mir-1174supercont1.125: 1647825-1647942 [+]
aae-mir-1175supercont1.125: 1648025-1648108 [+]
Database links

Mature sequence aae-miR-1175-5p

Accession MIMAT0014264
Previous IDsaae-miR-1175
Sequence

13 -  

aaguggaguaguggucucaucg

 - 34

Get sequence
Deep sequencing62 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

Mature sequence aae-miR-1175-3p

Accession MIMAT0015371
Previous IDsaae-miR-1175*
Sequence

51 -  

ugagauucuacuucuccgacuuaa

 - 74

Get sequence
Deep sequencing9 reads, 2 experiments
Evidence experimental; 454 [1]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).