Stem-loop sequence aae-mir-1174

AccessionMI0013471 (change log)
DescriptionAedes aegypti miR-1174 stem-loop
Literature search

3 open access papers mention aae-mir-1174
(20 sentences)

Stem-loop 
   acuccaauuc        --u      cu     uaguuacgu      a   ac     uucu    u 
5'           uggguauu   uagauc  uggca         gauuga ugc  uguuc    uugg u
             ||||||||   ||||||  |||||         |||||| |||  |||||    |||| u
3'           acccauaa   aucuag  acugu         cuaacu gcg  acaag    gacc a
   --------au        uuc      --     ---------      -   -c     cuau    c
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.125: 1647825-1647942 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-1174
aae-mir-1174supercont1.125: 1647825-1647942 [+]
aae-mir-1175supercont1.125: 1648025-1648108 [+]
Database links

Mature sequence aae-miR-1174

Accession MIMAT0014265
Sequence

97 -  

ucagaucuacuuaauacccau

 - 117

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).