![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-1174 |
||||||
Accession | MI0013471 (change log) | |||||
Description | Aedes aegypti miR-1174 stem-loop | |||||
Literature search |
![]()
3 open access papers mention aae-mir-1174 | |||||
Stem-loop |
acuccaauuc --u cu uaguuacgu a ac uucu u 5' uggguauu uagauc uggca gauuga ugc uguuc uugg u |||||||| |||||| ||||| |||||| ||| ||||| |||| u 3' acccauaa aucuag acugu cuaacu gcg acaag gacc a --------au uuc -- --------- - -c cuau c |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence aae-miR-1174 |
|
Accession | MIMAT0014265 |
Sequence |
97 - ucagaucuacuuaauacccau - 117 |
Deep sequencing | 2 reads, 1 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|