Stem-loop sequence aae-mir-981

AccessionMI0013473 (change log)
DescriptionAedes aegypti miR-981 stem-loop
Gene family MIPF0000710; mir-981
Literature search

2 open access papers mention aae-mir-981
(2 sentences)

Stem-loop 
   aaa      -c  gau         -    g        u caccau 
5'    ccuugc  ug   cggguuucg cggc aacgggcu c      g
      ||||||  ||   ||||||||| |||| |||||||| |       
3'    ggaacg  ac   guccaaagc gcug uugcuuga g      a
   -ac      uu  -ac         a    -        c auaagu
Get sequence
Deep sequencing
20008 reads, 900 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.127: 638368-638458 [-]
intergenic
Database links

Mature sequence aae-miR-981

Accession MIMAT0014267
Sequence

58 -  

uucguugucgacgaaaccugca

 - 79

Get sequence
Deep sequencing19286 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).