Stem-loop sequence aae-mir-932

Accession

MI0013475 (change log)

Description

Aedes aegypti miR-932 stem-loop

Gene family

MIPF0000588; mir-932

Literature search

2 open access papers mention aae-mir-932
(7 sentences)

Stem-loop

   -gua     --     a      a       g   a       g  - u 
5'     aucau  agaau gcuuca uuccgua ugc uugcagu ug c u
       |||||  ||||| |||||| ||||||| ||| ||||||| || |  
3'     uagua  ucuua cgaagu aaggugu acg aacguca gc g u
   cuac     ac     g      g       a   -       a  a a 

Deep sequencing

97883 reads, 4.65e+03 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context

• Coordinates (AaegL1): supercont1.1064: 154098-154192 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0013475

Mature sequence aae-miR-932-5p

• Accession: MIMAT0014269
• Previous IDs: aae-miR-932*
• Sequence: 18 - ucaauuccguagugcauugcag - 39
• Deep sequencing: 43753 reads, 2 experiments
• Evidence: experimental; Illumina [2]

Mature sequence aae-miR-932-3p

• Accession: MIMAT0014270
• Previous IDs: aae-miR-932
• Sequence: 56 - ugcaagcaauguggaagugaag - 77
• Deep sequencing: 54128 reads, 2 experiments
• Evidence: experimental; 454 [1], Illumina [2]

References

1. PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2. PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).