Stem-loop sequence aae-mir-927

AccessionMI0013476 (change log)
DescriptionAedes aegypti miR-927 stem-loop
Gene family MIPF0000452; mir-927
Literature search

2 open access papers mention aae-mir-927
(2 sentences)

Stem-loop 
   gg    c          cu       a   u     g 
5'   uuug uuuagaauuc  acgcuuu ccg gauuu u
     |||| ||||||||||  ||||||| ||| ||||| u
3'   aagc aagucuuggg  ugcgaaa ggu uugaa g
   ca    a          uu       c   -     a
Get sequence
Deep sequencing
29442 reads, 1.45e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.26: 2065412-2065487 [+]
intergenic
Database links

Mature sequence aae-miR-927

Accession MIMAT0014271
Sequence

50 -  

caaagcguuuggguucugaaac

 - 71

Get sequence
Deep sequencing850 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).