![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-309a-2 |
||||||
Accession | MI0013478 (change log) | |||||
Description | Aedes aegypti miR-309a-2 stem-loop | |||||
Gene family | MIPF0000140; mir-3 | |||||
Literature search |
2 open access papers mention aae-mir-309a-2 | |||||
Stem-loop |
uccaccgaaug u c uu -----ucau g 5' uuaugcgac aacuu guucagu ggug ac a ||||||||| ||||| ||||||| |||| || 3' aauacgcug uugaa cggguca cuac ug a --------gua u a -- uuugaccuu g |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Comments |
This miRNA was experimentally identified in the closely related Aedes albopictus in [2], for which there was no genome sequence, and therefore mapped to the Aedes aegypti genome. Li et al. also validate the expression in A. aegypti [1]. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence aae-miR-309a |
|
Accession | MIMAT0014272 |
Sequence |
64 - ucacugggcaaaguuugucgc - 84 |
Deep sequencing | 16 reads, 2 experiments |
Evidence | experimental; Illumina [1], 454 [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|