Stem-loop sequence aae-mir-309a-2

AccessionMI0013478 (change log)
DescriptionAedes aegypti miR-309a-2 stem-loop
Gene family MIPF0000140; mir-3
Literature search

2 open access papers mention aae-mir-309a-2
(3 sentences)

Stem-loop 
   uccaccgaaug         u     c       uu    -----ucau  g 
5'            uuaugcgac aacuu guucagu  ggug         ac a
              ||||||||| ||||| |||||||  ||||         ||  
3'            aauacgcug uugaa cggguca  cuac         ug a
   --------gua         u     a       --    uuugaccuu  g
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was experimentally identified in the closely related Aedes albopictus in [2], for which there was no genome sequence, and therefore mapped to the Aedes aegypti genome. Li et al. also validate the expression in A. aegypti [1].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.602: 94025-94115 [+]
intergenic
Clustered miRNAs
< 10kb from aae-mir-309a-2
aae-mir-286b-2supercont1.602: 93476-93572 [+]
aae-mir-309a-2supercont1.602: 94025-94115 [+]
Database links

Mature sequence aae-miR-309a

Accession MIMAT0014272
Sequence

64 -  

ucacugggcaaaguuugucgc

 - 84

Get sequence
Deep sequencing16 reads, 2 experiments
Evidence experimental; Illumina [1], 454 [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).