Stem-loop sequence aae-mir-137-1

AccessionMI0013480 (change log)
DescriptionAedes aegypti miR-137-1 stem-loop
Gene family MIPF0000106; mir-137
Literature search

1 open access papers mention aae-mir-137-1
(2 sentences)

Stem-loop 
   -uucauc     a    g ug  c   c       ug   uau     c  ug 
5'        gagca cuug u  gc acg guauucu  ggu   uaaca ac  u
          ||||| |||| |  || ||| |||||||  |||   ||||| ||  u
3'        uuugu gaac a  ug ugc cauaaga  ucg   auugu ug  u
   gcuacac     -    - gu  a   a       gu   -uu     -  ua
Get sequence
Deep sequencing
11903 reads, 500 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.1191: 97782-97885 [+]
intergenic
Database links

Mature sequence aae-miR-137

Accession MIMAT0014274
Sequence

63 -  

uauugcuugagaauacacguag

 - 84

Get sequence
Deep sequencing22400 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).