![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-137-1 |
|||||
Accession | MI0013480 (change log) | ||||
Description | Aedes aegypti miR-137-1 stem-loop | ||||
Gene family | MIPF0000106; mir-137 | ||||
Literature search |
1 open access papers mention aae-mir-137-1 | ||||
Stem-loop |
-uucauc a g ug c c ug uau c ug 5' gagca cuug u gc acg guauucu ggu uaaca ac u ||||| |||| | || ||| ||||||| ||| ||||| || u 3' uuugu gaac a ug ugc cauaaga ucg auugu ug u gcuacac - - gu a a gu -uu - ua |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-miR-137 |
|
Accession | MIMAT0014274 |
Sequence |
63 - uauugcuugagaauacacguag - 84 |
Deep sequencing | 22400 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|