![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-10 |
|||||
Accession | MI0013484 (change log) | ||||
Description | Aedes aegypti miR-10 stem-loop | ||||
Gene family | MIPF0000033; mir-10 | ||||
Literature search |
2 open access papers mention aae-mir-10 | ||||
Stem-loop |
uu cu - g u ugaauau 5' uguucuacau acc cu uaga ccgaauuuguu u |||||||||| ||| || |||| ||||||||||| 3' acggggugug ugg ga aucu ggcuuaaacag u uu uu a g u cgaacaa |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-miR-10 |
|
Accession | MIMAT0014277 |
Sequence |
15 - acccuguagauccgaauuuguu - 36 |
Deep sequencing | 3180 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|