Stem-loop sequence aae-mir-10

AccessionMI0013484 (change log)
DescriptionAedes aegypti miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

2 open access papers mention aae-mir-10
(5 sentences)

Stem-loop 
   uu          cu   -  g    u           ugaauau 
5'   uguucuacau  acc cu uaga ccgaauuuguu       u
     ||||||||||  ||| || |||| |||||||||||        
3'   acggggugug  ugg ga aucu ggcuuaaacag       u
   uu          uu   a  g    u           cgaacaa
Get sequence
Deep sequencing
45604 reads, 2.05e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.440: 813543-813631 [+]
intergenic
Database links

Mature sequence aae-miR-10

Accession MIMAT0014277
Sequence

15 -  

acccuguagauccgaauuuguu

 - 36

Get sequence
Deep sequencing3180 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).